Regulon of ModE in Magnetospirillum magneticum AMB-1

Properties
Regulator type:	Transcription factor
TF locus tag:	amb2949
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodospirillales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -289 Score: 7 Sequence: TCGAAATGTAGTTCATGTATATAGCGA Locus tag: amb2950 Name: modX Funciton: Predicted molibdenum binding protein
	amb2950	modX	Predicted molibdenum binding protein
Position: -39 Score: 5.5 Sequence: TCGTCATATAGTGCGCATACATGACGA Locus tag: amb2949 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	amb2949	modE	Molybdate-responsive transcriptional regulator ModE
Position: -47 Score: 7 Sequence: TCGCTATATACATGAACTACATTTCGA Locus tag: amb2951 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: amb2952 Name: modQ2 Funciton: Predicted molybdenum delivery protein Locus tag: amb2953 Name: modD Funciton: Molybdenum transport system protein ModD
	amb2951	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	amb2952	modQ2	Predicted molybdenum delivery protein
	amb2953	modD	Molybdenum transport system protein ModD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD