Regulon of ModE in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03009350
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodospirillales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -198 Score: 5.8 Sequence: CCGCTATATTGTCGAGATAAATACCGA Position: -48 Score: 6.7 Sequence: TCGCTATATACCTTAACTACATTTCGT Locus tag: Magn03010295 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Magn03010294 Name: modQ1 Funciton: Predicted molybdenum delivery protein Locus tag: Magn03010293 Name: modD Funciton: Molybdenum transport system protein ModD
	Magn03010295	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Magn03010294	modQ1	Predicted molybdenum delivery protein
	Magn03010293	modD	Molybdenum transport system protein ModD
Position: -10 Score: 6.3 Sequence: TCGTAATATAGTGTGGCTACATGACGA Locus tag: Magn03009350 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	Magn03009350	modE	Molybdate-responsive transcriptional regulator ModE
Position: -198 Score: 5.8 Sequence: TCGGTATTTATCTCGACAATATAGCGG Locus tag: Magn03010296 Name: modX Funciton: Predicted molibdenum binding protein
	Magn03010296	modX	Predicted molibdenum binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD