Regulog NrtR - Flavobacteria
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Flavobacteria
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Blattabacterium sp. (Blattella germanica) str. Bge | ||
| Candidatus Sulcia muelleri SMDSEM | ||
| Capnocytophaga ochracea DSM 7271 | ||
| Cellulophaga sp. MED134 | ||
| Croceibacter atlanticus HTCC2559 | ||
| Flavobacteria bacterium BAL38 | ||
| Flavobacteria bacterium BBFL7 | ||
| Flavobacteriaceae bacterium 3519-10 | ||
| Flavobacteriales bacterium ALC-1 | ||
| Flavobacteriales bacterium HTCC2170 | ||
| Flavobacterium johnsoniae UW101 | 2 | 1 |
| Flavobacterium psychrophilum JIP02/86 | ||
| Gramella forsetii KT0803 | ||
| Kordia algicida OT-1 | 1 | 1 |
| Leeuwenhoekiella blandensis MED217 | ||
| Polaribacter irgensii 23-P | ||
| Psychroflexus torquis ATCC 700755 | ||
| Robiginitalea biformata HTCC2501 | ||
| Tenacibaculum sp. MED152 |
| Genes | Function | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||||||
| prs |
|
|
|
|
|
|
|
|
|
|
*
Flavobacterium johnsoniae UW101 Site: position = -31 score = 6.98589 sequence = TTTGCGTATAATTAACGCAAA Site: position = -83 score = 6.70717 sequence = TTTGCGTAATTTTTACACAAA Gene: Fjoh_0755: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
|
|
*
Kordia algicida OT-1 Site: position = -22 score = 5.86314 sequence = TTTGCGTACAAATAACGCTAA Gene: KAOT1_16118: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
|
|
|
|
|
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
| Fjoh_0754 |
|
|
|
|
|
|
|
|
|
|
Gene: Fjoh_0754: hypothetical protein |
|
|
|
|
|
|
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |