Regulon of NrtR in Flavobacterium johnsoniae UW101

Properties
Regulator type:	Transcription factor
TF locus tag:	Fjoh_0756
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Flavobacteria
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Flavobacteria
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6.7 Sequence: TTTGCGTAATTTTTACACAAA Position: -31 Score: 7 Sequence: TTTGCGTATAATTAACGCAAA Locus tag: Fjoh_0755 Name: prs Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) Locus tag: Fjoh_0754 Name: null Funciton: hypothetical protein
	Fjoh_0755	prs	Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
	Fjoh_0754		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD