Regulon of NrtR in Kordia algicida OT-1

Properties
Regulator type:	Transcription factor
TF locus tag:	KAOT1_16113
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Flavobacteria
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Flavobacteria
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -22 Score: 5.9 Sequence: TTTGCGTACAAATAACGCTAA Locus tag: KAOT1_16118 Name: prs Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
	KAOT1_16118	prs	Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD