Regulog NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae

Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
Genome | Genes | Operons |
---|---|---|
Nakamurella multipartita DSM 44233 | ||
Frankia sp. EAN1pec | 4 | 3 |
Frankia sp. CcI3 | 1 | 1 |
Acidothermus cellulolyticus 11B | ||
Actinosynnema mirum DSM 43827 | ||
Saccharomonospora viridis DSM 43017 | ||
Saccharopolyspora erythraea NRRL 2338 | ||
Nocardioides sp. JS614 | ||
Propionibacterium acnes KPA171202 |
Genes | Function | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||
nadA |
Gene: Namu_3166: Quinolinate synthetase (EC 4.1.99.-) |
*
Frankia sp. EAN1pec Site: position = -97 score = 5.37492 sequence = TTAGAGTCTGAACGACCATTA Gene: Franean1_1796: Quinolinate synthetase (EC 4.1.99.-) |
*
Frankia sp. CcI3 Site: position = -106 score = 4.91899 sequence = TTAGAGTCTCATCGACCATTC Gene: Francci3_3122: Quinolinate synthetase (EC 4.1.99.-) |
Gene: Acel_1145: Quinolinate synthetase (EC 4.1.99.-) |
Gene: Amir_5730: Quinolinate synthetase (EC 4.1.99.-) |
Gene: Svir_10830: Quinolinate synthetase (EC 4.1.99.-) |
Gene: SACE_5803: Quinolinate synthetase (EC 4.1.99.-) |
Gene: Noca_3149: Quinolinate synthetase (EC 4.1.99.-) |
|
Quinolinate synthetase (EC 4.1.99.-) |
CRON 2. | ||||||||||
PF01145 |
|
*
Frankia sp. EAN1pec Site: position = -87 score = 4.65295 sequence = ATCTCGTCAGGTTGACGAGAA Site: position = -41 score = 6.1613 sequence = TTATCGTCAGTTCGACGATAA Gene: Franean1_6652: band 7 protein |
|
|
|
|
|
|
|
band 7 protein |
nadF |
|
Gene: Franean1_6651: ATP-NAD kinase, PpnK-type |
|
|
|
|
|
|
|
ATP-NAD kinase, PpnK-type |
CRON 3. | ||||||||||
nrtR |
|
*
Frankia sp. EAN1pec Site: position = -79 score = 6.1613 sequence = TTATCGTCGAACTGACGATAA Site: position = -33 score = 4.65295 sequence = TTCTCGTCAACCTGACGAGAT Gene: Franean1_6653: Nudix-related transcriptional regulator NrtR |
|
|
|
|
|
|
|
Nudix-related transcriptional regulator NrtR |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |