Regulon of NrtR in Frankia sp. EAN1pec

Properties
Regulator type:	Transcription factor
TF locus tag:	Franean1_6653
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -79 Score: 6.2 Sequence: TTATCGTCGAACTGACGATAA Position: -33 Score: 4.7 Sequence: TTCTCGTCAACCTGACGAGAT Locus tag: Franean1_6653 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	Franean1_6653	nrtR	Nudix-related transcriptional regulator NrtR
Position: -87 Score: 4.7 Sequence: ATCTCGTCAGGTTGACGAGAA Position: -41 Score: 6.2 Sequence: TTATCGTCAGTTCGACGATAA Locus tag: Franean1_6652 Name: PF01145 Funciton: band 7 protein Locus tag: Franean1_6651 Name: nadF Funciton: ATP-NAD kinase, PpnK-type
	Franean1_6652	PF01145	band 7 protein
	Franean1_6651	nadF	ATP-NAD kinase, PpnK-type
Position: -97 Score: 5.4 Sequence: TTAGAGTCTGAACGACCATTA Locus tag: Franean1_1796 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	Franean1_1796	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD