Profile of regulator NrtR in Frankineae/Propionibacterineae/Pseudonocardiaceae
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Regulog: | NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Frankia sp. EAN1pec | |||||
| Franean1_1796 | nadA | -97 | 5.4 | TTAGAGTCTGAACGACCATTA | |
| Franean1_6652 | PF01145 | -87 | 4.7 | ATCTCGTCAGGTTGACGAGAA | |
| Franean1_6652 | PF01145 | -41 | 6.2 | TTATCGTCAGTTCGACGATAA | |
| Franean1_6653 | nrtR | -79 | 6.2 | TTATCGTCGAACTGACGATAA | |
| Franean1_6653 | nrtR | -33 | 4.7 | TTCTCGTCAACCTGACGAGAT | |
| Frankia sp. CcI3 | |||||
| Francci3_3122 | nadA | -106 | 4.9 | TTAGAGTCTCATCGACCATTC | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |