Regulon of NrtR in Frankia sp. CcI3
| Regulator type: | Transcription factor |
| TF locus tag: | |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Regulog: | NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -106
Score: 4.9 Sequence: TTAGAGTCTCATCGACCATTC
Locus tag: Francci3_3122
Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) |
|||
|
nadA
|
Quinolinate synthetase (EC 4.1.99.-)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |