Regulog Cbei_4343 - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | ||
| Clostridium beijerincki NCIMB 8052 | 3 | 1 |
| Clostridium botulinum A str. ATCC 3502 | 4 | 2 |
| Clostridium butyricum 5521 | ||
| Clostridium kluyveri DSM 555 | 3 | 1 |
| Clostridium novyi NT | 3 | 1 |
| Clostridium perfringens ATCC 13124 | 4 | 1 |
| Clostridium tetani E88 | 6 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| Cbei_4343 |
|
*
Clostridium beijerincki NCIMB 8052 Site: position = -60 score = 8.78449 sequence = TGTTCATACTGTATATATTGTATATATACAGTATGAACA Gene: Cbei_4343: Transcriptional regulator, GntR family |
*2
Clostridium botulinum A str. ATCC 3502 Site: position = -61 score = 8.20342 sequence = AACACATACTGTATATATTATATATATACAGTATGTACG Gene: CBO2918: Transcriptional regulator, GntR family Site: position = -55 score = 5.9812 sequence = TGTGTATAGTGTGTATTGTACATATACACACTGATTATG Gene: CBO2066: Transcriptional regulator, GntR family |
|
*
Clostridium kluyveri DSM 555 Site: position = -51 score = 8.1621 sequence = TGTGAACATTGTATATATTATATATATACAATGTTCACA Gene: CKL_0385: Transcriptional regulator, GntR family |
*
Clostridium novyi NT Site: position = -54 score = 9.17523 sequence = TGTATATACTGTATATAAAGAATATATACAGTATATACA Gene: NT01CX_2435: Transcriptional regulator, GntR family |
*
Clostridium perfringens ATCC 13124 Site: position = -56 score = 9.32793 sequence = TGTATATACTGTATATATAGAATATATACAGTATATACA Gene: CPF_0445: Transcriptional regulator, GntR family |
*2
Clostridium tetani E88 Gene: CTC01893: Transcriptional regulator, GntR family Site: position = -55 score = 8.70897 sequence = TGTATATACTGTATATATACGATATGCACAGTATATACA Gene: CTC00804: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| BH0652 |
|
Gene: Cbei_4342: ABC-type multidrug transport system, ATPase component |
2
Clostridium botulinum A str. ATCC 3502 Gene: CBO2917: ABC-type multidrug transport system, ATPase component Gene: CBO2065: ABC-type multidrug transport system, ATPase component |
|
Gene: CKL_0384: ABC-type multidrug transport system, ATPase component |
Gene: NT01CX_2434: ABC-type multidrug transport system, ATPase component |
Gene: CPF_0446: ABC-type multidrug transport system, ATPase component |
2
Clostridium tetani E88 Gene: CTC01892: ABC-type multidrug transport system, ATPase component Gene: CTC00803: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| BH0653 |
|
Gene: Cbei_4341: ABC-type multidrug transport system, permease component |
2
Clostridium botulinum A str. ATCC 3502 Gene: CBO2916: ABC-type multidrug transport system, permease component Gene: CBO2064: ABC-type multidrug transport system, permease component |
|
Gene: CKL_0383: ABC-type multidrug transport system, permease component |
Gene: NT01CX_2433: ABC-type multidrug transport system, permease component |
2
Clostridium perfringens ATCC 13124 Gene: CPF_0447: ABC-type multidrug transport system, permease component Gene: CPF_0448: ABC-type multidrug transport system, permease component |
5
Clostridium tetani E88 Gene: CTC00802: ABC-type multidrug transport system, permease component Gene: CTC00800: ABC-type multidrug transport system, permease component Gene: CTC01891: ABC-type multidrug transport system, permease component Gene: CTC00799: ABC-type multidrug transport system, permease component Gene: CTC00801: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |