Regulon of Cbei_4343 in Clostridium tetani E88

Properties
Regulator type:	Transcription factor
TF locus tag:	CTC00804, CTC01893
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Cbei_4343 - Clostridia-1
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 8.7 Sequence: TGTATATACTGTATATATACGATATGCACAGTATATACA Locus tag: CTC00804 Name: Cbei_4343 Funciton: Transcriptional regulator, GntR family Locus tag: CTC00803 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CTC00802 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: CTC00801 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: CTC00800 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: CTC00799 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	CTC00804	Cbei_4343	Transcriptional regulator, GntR family
	CTC00803	BH0652	ABC-type multidrug transport system, ATPase component
	CTC00802	BH0653	ABC-type multidrug transport system, permease component
	CTC00801	BH0653	ABC-type multidrug transport system, permease component
	CTC00800	BH0653	ABC-type multidrug transport system, permease component
	CTC00799	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD