Regulon of Cbei_4343 in Clostridium perfringens ATCC 13124

Properties
Regulator type:	Transcription factor
TF locus tag:	CPF_0445
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Cbei_4343 - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 9.3 Sequence: TGTATATACTGTATATATAGAATATATACAGTATATACA Locus tag: CPF_0445 Name: Cbei_4343 Funciton: Transcriptional regulator, GntR family Locus tag: CPF_0446 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CPF_0447 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: CPF_0448 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	CPF_0445	Cbei_4343	Transcriptional regulator, GntR family
	CPF_0446	BH0652	ABC-type multidrug transport system, ATPase component
	CPF_0447	BH0653	ABC-type multidrug transport system, permease component
	CPF_0448	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD