Regulon of Cbei_4343 in Clostridium botulinum A str. ATCC 3502

Properties
Regulator type:	Transcription factor
TF locus tag:	CBO2918, CBO2066
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Cbei_4343 - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 8.2 Sequence: AACACATACTGTATATATTATATATATACAGTATGTACG Locus tag: CBO2918 Name: Cbei_4343 Funciton: Transcriptional regulator, GntR family
	CBO2918	Cbei_4343	Transcriptional regulator, GntR family
Position: -55 Score: 6 Sequence: TGTGTATAGTGTGTATTGTACATATACACACTGATTATG Locus tag: CBO2066 Name: Cbei_4343 Funciton: Transcriptional regulator, GntR family Locus tag: CBO2065 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CBO2064 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	CBO2066	Cbei_4343	Transcriptional regulator, GntR family
	CBO2065	BH0652	ABC-type multidrug transport system, ATPase component
	CBO2064	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD