Regulog BH0651 - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Statistics of regulated genes
Genome	Genes	Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579	6	1
Bacillus clausii KSM-K16	5	2
Bacillus halodurans C-125	3	1
Bacillus licheniformis DSM 13	6	2
Bacillus pumilus SAFR-032	3	1
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
BH0651	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	* Bacillus cereus ATCC 14579 Site: position = -55 score = 8.91486 sequence = TGTATATACTGTATATATAAGGTATATACAGTATATACA Gene: BC4222: Transcriptional regulator, GntR family	* Bacillus clausii KSM-K16 Site: position = -306 score = 6.96126 sequence = TGTATATGATGGGCATATAGTATATATACATTATATGAA Gene: ABC0260: Transcriptional regulator, GntR family	* Bacillus halodurans C-125 Site: position = -157 score = 8.67992 sequence = TGTATATAATGTATATATAGTATATATACATTATATAAA Gene: BH0651: Transcriptional regulator, GntR family	2 Bacillus licheniformis DSM 13* Site: position = -58 score = 6.99098 sequence = TGTTATAACTGTTTATATTGTATATATACAGTTATAACG Gene: BLi02114: Transcriptional regulator, GntR family Site: position = -53 score = 7.46731 sequence = TGTGTATATTGTACATATTGTGTATATTGTATATAAACA Gene: BLi00208: Transcriptional regulator, GntR family	* Bacillus pumilus SAFR-032 Site: position = -73 score = 8.39334 sequence = TGTATATAATGTATATATAGTATATATACAATATTTTGT Gene: BPUM_0174: Transcriptional regulator, GntR family	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2 Gene: Pjdr2_3952: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
BH0652	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579 Gene: BC4221: ABC-type multidrug transport system, ATPase component	2 Bacillus clausii KSM-K16* Gene: ABC0261: ABC-type multidrug transport system, ATPase component Site: position = -195 score = 7.59427 sequence = CGTTATTTTTGTATATATATGATATATACAATATGAACA Site: position = -186 score = 7.00926 sequence = TGTATATATATGATATATACAATATGAACAAAATATACA Gene: ABC3528: ABC-type multidrug transport system, ATPase component	Bacillus halodurans C-125 Gene: BH0652: ABC-type multidrug transport system, ATPase component	2 Bacillus licheniformis DSM 13 Gene: BLi02113: ABC-type multidrug transport system, ATPase component Gene: BLi00207: ABC-type multidrug transport system, ATPase component	Bacillus pumilus SAFR-032 Gene: BPUM_0175: ABC-type multidrug transport system, ATPase component	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	* Paenibacillus sp. JDR-2 Site: position = -49 score = 5.91824 sequence = GTGATATATTGTGTATACACGACATACACAATTTGATCG Gene: Pjdr2_3954: ABC-type multidrug transport system, ATPase component	ABC-type multidrug transport system, ATPase component
BH0653	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	4 Bacillus cereus ATCC 14579 Gene: BC4217: ABC-type multidrug transport system, permease component Gene: BC4218: ABC-type multidrug transport system, permease component Gene: BC4219: ABC-type multidrug transport system, permease component Gene: BC4220: ABC-type multidrug transport system, permease component	2 Bacillus clausii KSM-K16 Gene: ABC3527: ABC-type multidrug transport system, permease component Gene: ABC0262: ABC-type multidrug transport system, permease component	Bacillus halodurans C-125 Gene: BH0653: ABC-type multidrug transport system, permease component	2 Bacillus licheniformis DSM 13 Gene: BLi02112: ABC-type multidrug transport system, permease component Gene: BLi00206: ABC-type multidrug transport system, permease component	Bacillus pumilus SAFR-032 Gene: BPUM_0176: ABC-type multidrug transport system, permease component	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2 Gene: Pjdr2_3953: ABC-type multidrug transport system, permease component	ABC-type multidrug transport system, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BH0651 - Bacillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --