Regulog BH0651 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | 6 | 1 |
| Bacillus clausii KSM-K16 | 5 | 2 |
| Bacillus halodurans C-125 | 3 | 1 |
| Bacillus licheniformis DSM 13 | 6 | 2 |
| Bacillus pumilus SAFR-032 | 3 | 1 |
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 3 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BH0651 |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -55 score = 8.91486 sequence = TGTATATACTGTATATATAAGGTATATACAGTATATACA Gene: BC4222: Transcriptional regulator, GntR family |
*
Bacillus clausii KSM-K16 Site: position = -306 score = 6.96126 sequence = TGTATATGATGGGCATATAGTATATATACATTATATGAA Gene: ABC0260: Transcriptional regulator, GntR family |
*
Bacillus halodurans C-125 Site: position = -157 score = 8.67992 sequence = TGTATATAATGTATATATAGTATATATACATTATATAAA Gene: BH0651: Transcriptional regulator, GntR family |
*2
Bacillus licheniformis DSM 13 Site: position = -58 score = 6.99098 sequence = TGTTATAACTGTTTATATTGTATATATACAGTTATAACG Gene: BLi02114: Transcriptional regulator, GntR family Site: position = -53 score = 7.46731 sequence = TGTGTATATTGTACATATTGTGTATATTGTATATAAACA Gene: BLi00208: Transcriptional regulator, GntR family |
*
Bacillus pumilus SAFR-032 Site: position = -73 score = 8.39334 sequence = TGTATATAATGTATATATAGTATATATACAATATTTTGT Gene: BPUM_0174: Transcriptional regulator, GntR family |
|
|
|
Gene: Pjdr2_3952: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| BH0652 |
|
|
Gene: BC4221: ABC-type multidrug transport system, ATPase component |
*2
Bacillus clausii KSM-K16 Gene: ABC0261: ABC-type multidrug transport system, ATPase component Site: position = -195 score = 7.59427 sequence = CGTTATTTTTGTATATATATGATATATACAATATGAACA Site: position = -186 score = 7.00926 sequence = TGTATATATATGATATATACAATATGAACAAAATATACA Gene: ABC3528: ABC-type multidrug transport system, ATPase component |
Gene: BH0652: ABC-type multidrug transport system, ATPase component |
2
Bacillus licheniformis DSM 13 Gene: BLi02113: ABC-type multidrug transport system, ATPase component Gene: BLi00207: ABC-type multidrug transport system, ATPase component |
Gene: BPUM_0175: ABC-type multidrug transport system, ATPase component |
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -49 score = 5.91824 sequence = GTGATATATTGTGTATACACGACATACACAATTTGATCG Gene: Pjdr2_3954: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| BH0653 |
|
|
4
Bacillus cereus ATCC 14579 Gene: BC4217: ABC-type multidrug transport system, permease component Gene: BC4218: ABC-type multidrug transport system, permease component Gene: BC4219: ABC-type multidrug transport system, permease component Gene: BC4220: ABC-type multidrug transport system, permease component |
2
Bacillus clausii KSM-K16 Gene: ABC3527: ABC-type multidrug transport system, permease component Gene: ABC0262: ABC-type multidrug transport system, permease component |
Gene: BH0653: ABC-type multidrug transport system, permease component |
2
Bacillus licheniformis DSM 13 Gene: BLi02112: ABC-type multidrug transport system, permease component Gene: BLi00206: ABC-type multidrug transport system, permease component |
Gene: BPUM_0176: ABC-type multidrug transport system, permease component |
|
|
|
Gene: Pjdr2_3953: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |