Regulon of BH0651 in Paenibacillus sp. JDR-2
| Regulator type: | Transcription factor |
| TF locus tag: | Pjdr2_3952 |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Regulog: | BH0651 - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -49
Score: 5.9 Sequence: GTGATATATTGTGTATACACGACATACACAATTTGATCG
Locus tag: Pjdr2_3954
Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Pjdr2_3953
Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
Locus tag: Pjdr2_3952
Name: BH0651 Funciton: Transcriptional regulator, GntR family |
|||
|
BH0652
|
ABC-type multidrug transport system, ATPase component
|
||
|
BH0653
|
ABC-type multidrug transport system, permease component
|
||
|
BH0651
|
Transcriptional regulator, GntR family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |