Regulon of BH0651 in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_3952
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	BH0651 - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.9 Sequence: GTGATATATTGTGTATACACGACATACACAATTTGATCG Locus tag: Pjdr2_3954 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Pjdr2_3953 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: Pjdr2_3952 Name: BH0651 Funciton: Transcriptional regulator, GntR family
	Pjdr2_3954	BH0652	ABC-type multidrug transport system, ATPase component
	Pjdr2_3953	BH0653	ABC-type multidrug transport system, permease component
	Pjdr2_3952	BH0651	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD