Regulon of BH0651 in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC0260
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	BH0651 - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -306 Score: 7 Sequence: TGTATATGATGGGCATATAGTATATATACATTATATGAA Locus tag: ABC0260 Name: BH0651 Funciton: Transcriptional regulator, GntR family Locus tag: ABC0261 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: ABC0262 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	ABC0260	BH0651	Transcriptional regulator, GntR family
	ABC0261	BH0652	ABC-type multidrug transport system, ATPase component
	ABC0262	BH0653	ABC-type multidrug transport system, permease component
Position: -195 Score: 7.6 Sequence: CGTTATTTTTGTATATATATGATATATACAATATGAACA Position: -186 Score: 7 Sequence: TGTATATATATGATATATACAATATGAACAAAATATACA Locus tag: ABC3528 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: ABC3527 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	ABC3528	BH0652	ABC-type multidrug transport system, ATPase component
	ABC3527	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD