Regulon of BH0651 in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC4222
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	BH0651 - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 8.9 Sequence: TGTATATACTGTATATATAAGGTATATACAGTATATACA Locus tag: BC4222 Name: BH0651 Funciton: Transcriptional regulator, GntR family Locus tag: BC4221 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BC4220 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: BC4219 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: BC4218 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: BC4217 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	BC4222	BH0651	Transcriptional regulator, GntR family
	BC4221	BH0652	ABC-type multidrug transport system, ATPase component
	BC4220	BH0653	ABC-type multidrug transport system, permease component
	BC4219	BH0653	ABC-type multidrug transport system, permease component
	BC4218	BH0653	ABC-type multidrug transport system, permease component
	BC4217	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD