Regulog XltR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Xylitol utilization |
| Effector: | Xylitol |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Xylitol
- By pathway - Xylitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM | 4 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| xltF |
|
|
|
|
|
|
|
|
|
|
|
*
Yersinia pestis KIM Site: position = 8 score = 6.53671 sequence = CAATGTTTACGTTGTCATTT Gene: y1686: Xylitol dehydrogenase (EC 1.1.1.9) |
Xylitol dehydrogenase (EC 1.1.1.9) |
| xltC |
|
|
|
|
|
|
|
|
|
|
|
Gene: y1687: Xylitol ABC transporter, periplasmic substrate-binding protein |
Xylitol ABC transporter, periplasmic substrate-binding protein |
| xltA |
|
|
|
|
|
|
|
|
|
|
|
Gene: y1688: Xylitol ABC transporter, ATP-binding component |
Xylitol ABC transporter, ATP-binding component |
| xltB |
|
|
|
|
|
|
|
|
|
|
|
Gene: y1689: Xylitol ABC transporter, permease component |
Xylitol ABC transporter, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |