Regulon of XltR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y1690
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xylitol utilization
Effector:	Xylitol
Regulog:	XltR - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Xylitol
By pathway - Xylitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: 8 Score: 6.5 Sequence: CAATGTTTACGTTGTCATTT Locus tag: y1686 Name: xltF Funciton: Xylitol dehydrogenase (EC 1.1.1.9) Locus tag: y1687 Name: xltC Funciton: Xylitol ABC transporter, periplasmic substrate-binding protein Locus tag: y1688 Name: xltA Funciton: Xylitol ABC transporter, ATP-binding component Locus tag: y1689 Name: xltB Funciton: Xylitol ABC transporter, permease component
	y1686	xltF	Xylitol dehydrogenase (EC 1.1.1.9)
	y1687	xltC	Xylitol ABC transporter, periplasmic substrate-binding protein
	y1688	xltA	Xylitol ABC transporter, ATP-binding component
	y1689	xltB	Xylitol ABC transporter, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD