Regulog Patl_0292 - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
| Genome | Genes | Operons |
|---|---|---|
| Alteromonadales bacterium TW-7 | ||
| Alteromonas macleodii 'Deep ecotype' | ||
| Colwellia psychrerythraea 34H | ||
| Glaciecola sp. HTCC2999 | ||
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR | ||
| Pseudoalteromonas atlantica T6c | 5 | 2 |
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| Patl_0291 |
|
|
|
|
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -78 score = 7.44869 sequence = CAACTAAACCGGTTTAGTAG Gene: Patl_0291: Putative racemase |
|
|
Putative racemase |
| Patl_0290 |
|
|
|
|
|
|
Gene: Patl_0290: Putative oxidoreductase |
|
|
Putative oxidoreductase |
| Patl_0289 |
|
|
|
|
|
|
Gene: Patl_0289: sodium-solute symporter, putative |
|
|
sodium-solute symporter, putative |
| Patl_0288 |
|
|
|
|
|
|
Gene: Patl_0288: Hypothetical protein |
|
|
Hypothetical protein |
| CRON 2. | ||||||||||
| Patl_0292 |
|
|
|
|
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -87 score = 7.44869 sequence = CTACTAAACCGGTTTAGTTG Gene: Patl_0292: Predicted transcriptional regulator, LacI family |
|
|
Predicted transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |