Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Patl_0288 gene

Properties
Regulog: Patl_0292 - Alteromonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudoalteromonas atlantica T6c
Position: -78
Score: 7.44869
Sequence: CAACTAAACCGGTTTAGTAG
Locus tag: Patl_0291
Name: Patl_0291
Funciton: Putative racemase
Locus tag: Patl_0290
Name: Patl_0290
Funciton: Putative oxidoreductase
Locus tag: Patl_0289
Name: Patl_0289
Funciton: sodium-solute symporter, putative
Locus tag: Patl_0288
Name: Patl_0288
Funciton: Hypothetical protein
Patl_0291-Patl_0290-Patl_0289-Patl_0288 -78 7.4 CAACTAAACCGGTTTAGTAG Patl_0291
© 2009-2020 RegPrecise