Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator Patl_0292 in Alteromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Regulog: Patl_0292 - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas atlantica T6c
Patl_0291 Patl_0291 -78 7.4 CAACTAAACCGGTTTAGTAG
Patl_0292 Patl_0292 -87 7.4 CTACTAAACCGGTTTAGTTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD