Profile of regulator Patl_0292 in Alteromonadales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Regulog: | Patl_0292 - Alteromonadales |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Pseudoalteromonas atlantica T6c | |||||
| Patl_0291 | Patl_0291 | -78 | 7.4 | CAACTAAACCGGTTTAGTAG | |
| Patl_0292 | Patl_0292 | -87 | 7.4 | CTACTAAACCGGTTTAGTTG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |