Regulon of Patl_0292 in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_0292
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Patl_0292 - Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 7.4 Sequence: CAACTAAACCGGTTTAGTAG Locus tag: Patl_0291 Name: Patl_0291 Funciton: Putative racemase Locus tag: Patl_0290 Name: Patl_0290 Funciton: Putative oxidoreductase Locus tag: Patl_0289 Name: Patl_0289 Funciton: sodium-solute symporter, putative Locus tag: Patl_0288 Name: Patl_0288 Funciton: Hypothetical protein
	Patl_0291	Patl_0291	Putative racemase
	Patl_0290	Patl_0290	Putative oxidoreductase
	Patl_0289	Patl_0289	sodium-solute symporter, putative
	Patl_0288	Patl_0288	Hypothetical protein
Position: -87 Score: 7.4 Sequence: CTACTAAACCGGTTTAGTTG Locus tag: Patl_0292 Name: Patl_0292 Funciton: Predicted transcriptional regulator, LacI family
	Patl_0292	Patl_0292	Predicted transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD