Regulog CcpB - Listeriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Listeria innocua Clip11262	2	1
Listeria monocytogenes EGD-e	2	1
Listeria seeligeri serovar 1/2b str. SLCC3954	2	1
Listeria welshimeri serovar 6b str. SLCC5334	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
lmo2738	* Listeria innocua Clip11262 Site: position = -47 score = 6.59898 sequence = GAAATTGTCCGGAATATTTT Gene: lin2881: Conserved hypothetical protein	* Listeria monocytogenes EGD-e Site: position = -72 score = 6.70997 sequence = CAAATTGTCCGGAATATTTA Gene: lmo2738: Conserved hypothetical protein	* Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -72 score = 6.8081 sequence = AAAATTGTCCGGAATATTTA Gene: lse_2651: Conserved hypothetical protein	* Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -72 score = 6.91909 sequence = TAAATTGTCCGGAATATTTA Gene: lwe2686: Conserved hypothetical protein	Conserved hypothetical protein
ccpB	Listeria innocua Clip11262 Gene: lin2880: Predicted transcriptional regulator CcpB, LacI family	Listeria monocytogenes EGD-e Gene: lmo2737: Predicted transcriptional regulator CcpB, LacI family	Listeria seeligeri serovar 1/2b str. SLCC3954 Gene: lse_2650: Predicted transcriptional regulator CcpB, LacI family	Listeria welshimeri serovar 6b str. SLCC5334 Gene: lwe2685: Predicted transcriptional regulator CcpB, LacI family	Predicted transcriptional regulator CcpB, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --