Regulon of CcpB in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type:	Transcription factor
TF locus tag:	lse_2650
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	CcpB - Listeriaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.8 Sequence: AAAATTGTCCGGAATATTTA Locus tag: lse_2651 Name: lmo2738 Funciton: Conserved hypothetical protein Locus tag: lse_2650 Name: ccpB Funciton: Predicted transcriptional regulator CcpB, LacI family
	lse_2651	lmo2738	Conserved hypothetical protein
	lse_2650	ccpB	Predicted transcriptional regulator CcpB, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD