Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator CcpB in Listeriaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Regulog: CcpB - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria innocua Clip11262
lin2881 lmo2738 -47 6.6 GAAATTGTCCGGAATATTTT
Listeria monocytogenes EGD-e
lmo2738 lmo2738 -72 6.7 CAAATTGTCCGGAATATTTA
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_2651 lmo2738 -72 6.8 AAAATTGTCCGGAATATTTA
Listeria welshimeri serovar 6b str. SLCC5334
lwe2686 lmo2738 -72 6.9 TAAATTGTCCGGAATATTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD