Regulog PhnR1 - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | 2-aminoethylphosphonate utilization |
| Effector: | 2-aminoethylphosphonate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - PhnR
- By TF family - GntR/Others
- By effector - 2-aminoethylphosphonate
- By pathway - 2-aminoethylphosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | 6 | 2 |
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| phnR1 |
|
|
|
|
|
|
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -162 score = 6.14112 sequence = TGGCTGGACTAGTCCAGCAA Gene: Spro_4489: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
|
2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
| CRON 2. | |||||||||||||
| phnS |
|
|
|
|
|
|
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -49 score = 6.14112 sequence = TTGCTGGACTAGTCCAGCCA Gene: Spro_4488: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
| Spro_4487 |
|
|
|
|
|
|
|
|
|
|
Gene: Spro_4487: type I phosphodiesterase |
|
type I phosphodiesterase |
| phnU |
|
|
|
|
|
|
|
|
|
|
Gene: Spro_4486: A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
| phnV |
|
|
|
|
|
|
|
|
|
|
Gene: Spro_4485: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
|
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
| phnT |
|
|
|
|
|
|
|
|
|
|
Gene: Spro_4484: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |