Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing phnS gene

Properties
Regulog: PhnR1 - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/Gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Serratia proteamaculans 568
Position: -49
Score: 6.14112
Sequence: TTGCTGGACTAGTCCAGCCA
Locus tag: Spro_4488
Name: phnS
Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: Spro_4487
Name: Spro_4487
Funciton: type I phosphodiesterase
Locus tag: Spro_4486
Name: phnU
Funciton: A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: Spro_4485
Name: phnV
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
Locus tag: Spro_4484
Name: phnT
Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnS-Spro_4487-phnU-phnV-phnT -49 6.1 TTGCTGGACTAGTCCAGCCA Spro_4488