Profile of regulator PhnR1 in Enterobacteriales

Properties
Regulator family:	GntR/Others
Regulation mode:
Biological process:	2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Regulog:	PhnR1 - Enterobacteriales

Member of regulog collections

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Serratia proteamaculans 568
	Spro_4489	phnR1	-162	6.1	TGGCTGGACTAGTCCAGCAA
	Spro_4488	phnS	-49	6.1	TTGCTGGACTAGTCCAGCCA

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --