Regulon of PhnR1 in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_4489
Regulator family:	GntR/Others
Regulation mode:
Biological process:	2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Regulog:	PhnR1 - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - PhnR
By TF family - GntR/Others
By effector - 2-aminoethylphosphonate
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -162 Score: 6.1 Sequence: TGGCTGGACTAGTCCAGCAA Locus tag: Spro_4489 Name: phnR1 Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	Spro_4489	phnR1	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Position: -49 Score: 6.1 Sequence: TTGCTGGACTAGTCCAGCCA Locus tag: Spro_4488 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: Spro_4487 Name: Spro_4487 Funciton: type I phosphodiesterase Locus tag: Spro_4486 Name: phnU Funciton: A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: Spro_4485 Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) Locus tag: Spro_4484 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	Spro_4488	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	Spro_4487	Spro_4487	type I phosphodiesterase
	Spro_4486	phnU	A2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	Spro_4485	phnV	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
	Spro_4484	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD