Regulog MalR - Sphingomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization
Effector:	Maltose
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Statistics of regulated genes
Genome	Genes	Operons
Erythrobacter litoralis HTCC2594	3	2
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444	6	2
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1
Sphingopyxis alaskensis RB2256	6	2
Zymomonas mobilis subsp. mobilis ZM4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
malR	* Erythrobacter litoralis HTCC2594 Site: position = -149 score = 5.56751 sequence = GATCGTATACGTATGTTTGT Gene: ELI_03155: Transcriptional regulator of maltose utilization, LacI family	Erythrobacter sp. NAP1	* Novosphingobium aromaticivorans DSM 12444 Site: position = -206 score = 5.49689 sequence = TATGGCATACGTATACTATG Gene: Saro_1887: Transcriptional regulator of maltose utilization, LacI family	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256 Gene: Sala_0597: Transcriptional regulator of maltose utilization, LacI family	Zymomonas mobilis subsp. mobilis ZM4	Transcriptional regulator of maltose utilization, LacI family

CRON 2.
omp(Mal)	Erythrobacter litoralis HTCC2594 Gene: ELI_03160: Predicted maltose-specific TonB-dependent receptor	Erythrobacter sp. NAP1	* Novosphingobium aromaticivorans DSM 12444 Site: position = -146 score = 4.65651 sequence = CATAGTATACGTATGCCATA Gene: Saro_1888: Predicted maltose-specific TonB-dependent receptor	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	* Sphingopyxis alaskensis RB2256 Site: position = -249 score = 4.23912 sequence = GATTCGATGCGTATACGTAT Gene: Sala_0181: Predicted maltose-specific TonB-dependent receptor	Zymomonas mobilis subsp. mobilis ZM4	Predicted maltose-specific TonB-dependent receptor
thl	Erythrobacter litoralis HTCC2594 Gene: ELI_03165: tryptophan halogenase, putative	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_1889: tryptophan halogenase, putative	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256 Gene: Sala_0182: tryptophan halogenase, putative	Zymomonas mobilis subsp. mobilis ZM4	tryptophan halogenase, putative
malY	Erythrobacter litoralis HTCC2594 Gene: ELI_03170: Maltodextrin glucosidase (EC 3.2.1.20)	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_1890: Maltodextrin glucosidase (EC 3.2.1.20)	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256 Gene: Sala_0183: Maltodextrin glucosidase (EC 3.2.1.20)	Zymomonas mobilis subsp. mobilis ZM4	Maltodextrin glucosidase (EC 3.2.1.20)
malZ	Erythrobacter litoralis HTCC2594 Gene: ELI_03175: Maltodextrin glucosidase (EC 3.2.1.20)	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_1891: Maltodextrin glucosidase (EC 3.2.1.20)	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256 Gene: Sala_0184: Maltodextrin glucosidase (EC 3.2.1.20)	Zymomonas mobilis subsp. mobilis ZM4	Maltodextrin glucosidase (EC 3.2.1.20)
malX	Erythrobacter litoralis HTCC2594 Gene: ELI_03180: Maltodextrin glucosidase (EC 3.2.1.20)	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_1892: Maltodextrin glucosidase (EC 3.2.1.20)	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256 Gene: Sala_0185: Maltodextrin glucosidase (EC 3.2.1.20)	Zymomonas mobilis subsp. mobilis ZM4	Maltodextrin glucosidase (EC 3.2.1.20)

CRON 3.
malT	* Erythrobacter litoralis HTCC2594 Site: position = -103 score = 5.69369 sequence = CATCACATTCGTATGCGTCT Gene: ELI_03150: Predicted maltose transporter MalT	Erythrobacter sp. NAP1 Gene: NAP1_09682: Predicted maltose transporter MalT	Novosphingobium aromaticivorans DSM 12444	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	* Sphingopyxis alaskensis RB2256 Site: position = -106 score = 5.47343 sequence = CCACGTATTCGTATACGCAA Gene: Sala_0596: Predicted maltose transporter MalT	Zymomonas mobilis subsp. mobilis ZM4	Predicted maltose transporter MalT
amy	Erythrobacter litoralis HTCC2594 Gene: ELI_03145: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18)	Erythrobacter sp. NAP1 Gene: NAP1_09677: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18)	Novosphingobium aromaticivorans DSM 12444	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Sphingopyxis alaskensis RB2256	Zymomonas mobilis subsp. mobilis ZM4	1,4-alpha-glucan branching enzyme (EC 2.4.1.18)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MalR - Sphingomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --