Regulog MalR - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | 3 | 2 |
| Erythrobacter sp. NAP1 | ||
| Novosphingobium aromaticivorans DSM 12444 | 6 | 2 |
| Sphingobium japonicum UT26S | ||
| Sphingomonas wittichii RW1 | ||
| Sphingopyxis alaskensis RB2256 | 6 | 2 |
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| malR |
*
Erythrobacter litoralis HTCC2594 Site: position = -149 score = 5.56751 sequence = GATCGTATACGTATGTTTGT Gene: ELI_03155: Transcriptional regulator of maltose utilization, LacI family |
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -206 score = 5.49689 sequence = TATGGCATACGTATACTATG Gene: Saro_1887: Transcriptional regulator of maltose utilization, LacI family |
|
|
Gene: Sala_0597: Transcriptional regulator of maltose utilization, LacI family |
|
Transcriptional regulator of maltose utilization, LacI family |
| CRON 2. | ||||||||
| omp(Mal) |
Gene: ELI_03160: Predicted maltose-specific TonB-dependent receptor |
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -146 score = 4.65651 sequence = CATAGTATACGTATGCCATA Gene: Saro_1888: Predicted maltose-specific TonB-dependent receptor |
|
|
*
Sphingopyxis alaskensis RB2256 Site: position = -249 score = 4.23912 sequence = GATTCGATGCGTATACGTAT Gene: Sala_0181: Predicted maltose-specific TonB-dependent receptor |
|
Predicted maltose-specific TonB-dependent receptor |
| thl |
Gene: ELI_03165: tryptophan halogenase, putative |
|
Gene: Saro_1889: tryptophan halogenase, putative |
|
|
Gene: Sala_0182: tryptophan halogenase, putative |
|
tryptophan halogenase, putative |
| malY |
Gene: ELI_03170: Maltodextrin glucosidase (EC 3.2.1.20) |
|
Gene: Saro_1890: Maltodextrin glucosidase (EC 3.2.1.20) |
|
|
Gene: Sala_0183: Maltodextrin glucosidase (EC 3.2.1.20) |
|
Maltodextrin glucosidase (EC 3.2.1.20) |
| malZ |
Gene: ELI_03175: Maltodextrin glucosidase (EC 3.2.1.20) |
|
Gene: Saro_1891: Maltodextrin glucosidase (EC 3.2.1.20) |
|
|
Gene: Sala_0184: Maltodextrin glucosidase (EC 3.2.1.20) |
|
Maltodextrin glucosidase (EC 3.2.1.20) |
| malX |
Gene: ELI_03180: Maltodextrin glucosidase (EC 3.2.1.20) |
|
Gene: Saro_1892: Maltodextrin glucosidase (EC 3.2.1.20) |
|
|
Gene: Sala_0185: Maltodextrin glucosidase (EC 3.2.1.20) |
|
Maltodextrin glucosidase (EC 3.2.1.20) |
| CRON 3. | ||||||||
| malT |
*
Erythrobacter litoralis HTCC2594 Site: position = -103 score = 5.69369 sequence = CATCACATTCGTATGCGTCT Gene: ELI_03150: Predicted maltose transporter MalT |
Gene: NAP1_09682: Predicted maltose transporter MalT |
|
|
|
*
Sphingopyxis alaskensis RB2256 Site: position = -106 score = 5.47343 sequence = CCACGTATTCGTATACGCAA Gene: Sala_0596: Predicted maltose transporter MalT |
|
Predicted maltose transporter MalT |
| amy |
Gene: ELI_03145: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
Gene: NAP1_09677: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
|
|
|
|
|
1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |