Regulon of MalR in Sphingopyxis alaskensis RB2256

Properties
Regulator type:	Transcription factor
TF locus tag:	Sala_0597
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization
Effector:	Maltose
Regulog:	MalR - Sphingomonadales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 5.5 Sequence: CCACGTATTCGTATACGCAA Locus tag: Sala_0596 Name: malT Funciton: Predicted maltose transporter MalT
	Sala_0596	malT	Predicted maltose transporter MalT
Position: -249 Score: 4.2 Sequence: GATTCGATGCGTATACGTAT Locus tag: Sala_0181 Name: omp(Mal) Funciton: Predicted maltose-specific TonB-dependent receptor Locus tag: Sala_0182 Name: thl Funciton: tryptophan halogenase, putative Locus tag: Sala_0183 Name: malY Funciton: Maltodextrin glucosidase (EC 3.2.1.20) Locus tag: Sala_0184 Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20) Locus tag: Sala_0185 Name: malX Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	Sala_0181	omp(Mal)	Predicted maltose-specific TonB-dependent receptor
	Sala_0182	thl	tryptophan halogenase, putative
	Sala_0183	malY	Maltodextrin glucosidase (EC 3.2.1.20)
	Sala_0184	malZ	Maltodextrin glucosidase (EC 3.2.1.20)
	Sala_0185	malX	Maltodextrin glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD