Regulon of MalR in Novosphingobium aromaticivorans DSM 12444

Properties
Regulator type:	Transcription factor
TF locus tag:	Saro_1887
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization
Effector:	Maltose
Regulog:	MalR - Sphingomonadales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -206 Score: 5.5 Sequence: TATGGCATACGTATACTATG Locus tag: Saro_1887 Name: malR Funciton: Transcriptional regulator of maltose utilization, LacI family
	Saro_1887	malR	Transcriptional regulator of maltose utilization, LacI family
Position: -146 Score: 4.7 Sequence: CATAGTATACGTATGCCATA Locus tag: Saro_1888 Name: omp(Mal) Funciton: Predicted maltose-specific TonB-dependent receptor Locus tag: Saro_1889 Name: thl Funciton: tryptophan halogenase, putative Locus tag: Saro_1890 Name: malY Funciton: Maltodextrin glucosidase (EC 3.2.1.20) Locus tag: Saro_1891 Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20) Locus tag: Saro_1892 Name: malX Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	Saro_1888	omp(Mal)	Predicted maltose-specific TonB-dependent receptor
	Saro_1889	thl	tryptophan halogenase, putative
	Saro_1890	malY	Maltodextrin glucosidase (EC 3.2.1.20)
	Saro_1891	malZ	Maltodextrin glucosidase (EC 3.2.1.20)
	Saro_1892	malX	Maltodextrin glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD