Regulon of MalR in Erythrobacter litoralis HTCC2594

Properties
Regulator type:	Transcription factor
TF locus tag:	ELI_03155
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization
Effector:	Maltose
Regulog:	MalR - Sphingomonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 5.7 Sequence: CATCACATTCGTATGCGTCT Locus tag: ELI_03150 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: ELI_03145 Name: amy Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
	ELI_03150	malT	Predicted maltose transporter MalT
	ELI_03145	amy	1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
Position: -149 Score: 5.6 Sequence: GATCGTATACGTATGTTTGT Locus tag: ELI_03155 Name: malR Funciton: Transcriptional regulator of maltose utilization, LacI family
	ELI_03155	malR	Transcriptional regulator of maltose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD