Regulog KglR - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | ||
| Paracoccus denitrificans PD1222 | 7 | 1 |
| Rhodobacter sphaeroides 2.4.1 | ||
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| Sma0079 |
|
|
|
|
|
|
*
Paracoccus denitrificans PD1222 Site: position = -52 score = 6.36089 sequence = GATTTAGATCGTTCTAAATC Gene: Pden_5079: amino acid ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
amino acid ABC transporter, inner membrane protein |
| Sma0081 |
|
|
|
|
|
|
Gene: Pden_5080: amino acid ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
amino acid ABC transporter, inner membrane protein |
| Sma0082 |
|
|
|
|
|
|
Gene: Pden_5081: amino acid ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
amino acid ABC transporter, substrate-binding protein |
| Sma0083 |
|
|
|
|
|
|
Gene: Pden_5082: amino acid ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
amino acid ABC transporter, ATP-binding protein |
| PF00389 |
|
|
|
|
|
|
Gene: Pden_5083: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding |
|
|
|
|
|
|
|
|
D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding |
| Pden_5084 |
|
|
|
|
|
|
Gene: Pden_5084: sugar kinase, PfkB family |
|
|
|
|
|
|
|
|
sugar kinase, PfkB family |
| COG3971 |
|
|
|
|
|
|
Gene: Pden_5085: 2-keto-4-pentenoate hydratase |
|
|
|
|
|
|
|
|
2-keto-4-pentenoate hydratase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |