Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sma0083 gene

Properties
Regulog: KglR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -52
Score: 6.36089
Sequence: GATTTAGATCGTTCTAAATC
Locus tag: Pden_5079
Name: Sma0079
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: Pden_5080
Name: Sma0081
Funciton: amino acid ABC transporter, inner membrane protein
Locus tag: Pden_5081
Name: Sma0082
Funciton: amino acid ABC transporter, substrate-binding protein
Locus tag: Pden_5082
Name: Sma0083
Funciton: amino acid ABC transporter, ATP-binding protein
Locus tag: Pden_5083
Name: PF00389
Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
Locus tag: Pden_5084
Name: Pden_5084
Funciton: sugar kinase, PfkB family
Locus tag: Pden_5085
Name: COG3971
Funciton: 2-keto-4-pentenoate hydratase
Sma0079-Sma0081-Sma0082-Sma0083-PF00389-Pden_5084-COG3971 -52 6.4 GATTTAGATCGTTCTAAATC Pden_5079