Regulon of KglR in Paracoccus denitrificans PD1222

Properties
Regulator type:	Transcription factor
TF locus tag:	Pden_5078
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	KglR - Rhodobacterales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6.4 Sequence: GATTTAGATCGTTCTAAATC Locus tag: Pden_5079 Name: Sma0079 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: Pden_5080 Name: Sma0081 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: Pden_5081 Name: Sma0082 Funciton: amino acid ABC transporter, substrate-binding protein Locus tag: Pden_5082 Name: Sma0083 Funciton: amino acid ABC transporter, ATP-binding protein Locus tag: Pden_5083 Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding Locus tag: Pden_5084 Name: Pden_5084 Funciton: sugar kinase, PfkB family Locus tag: Pden_5085 Name: COG3971 Funciton: 2-keto-4-pentenoate hydratase
	Pden_5079	Sma0079	amino acid ABC transporter, inner membrane protein
	Pden_5080	Sma0081	amino acid ABC transporter, inner membrane protein
	Pden_5081	Sma0082	amino acid ABC transporter, substrate-binding protein
	Pden_5082	Sma0083	amino acid ABC transporter, ATP-binding protein
	Pden_5083	PF00389	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
	Pden_5084	Pden_5084	sugar kinase, PfkB family
	Pden_5085	COG3971	2-keto-4-pentenoate hydratase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD