Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator KglR in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: KglR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Paracoccus denitrificans PD1222
Pden_5079 Sma0079 -52 6.4 GATTTAGATCGTTCTAAATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise