Profile of regulator KglR in Rhodobacterales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | KglR - Rhodobacterales |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Paracoccus denitrificans PD1222 | |||||
| Pden_5079 | Sma0079 | -52 | 6.4 | GATTTAGATCGTTCTAAATC | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |