Regulog KglR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | 7 | 1 |
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 6 | 1 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| kglR |
|
*
Azorhizobium caulinodans ORS 571 Site: position = -163 score = 5.57097 sequence = GTTTTAGATCGGTCTAAAAA Gene: AZC_4404: Transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
|
|
|
Gene: SMa0078: Transcriptional regulator, LacI family |
|
Transcriptional regulator, LacI family |
| Sma0079 |
|
Gene: AZC_4405: amino acid ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
|
|
|
*
Sinorhizobium meliloti 1021 Site: position = -77 score = 5.88243 sequence = ATTTTAGATCGATCTAACTG Gene: SMa0079: amino acid ABC transporter, inner membrane protein |
|
amino acid ABC transporter, inner membrane protein |
| Sma0081 |
|
Gene: AZC_4406: amino acid ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
|
|
|
Gene: SMa0081: amino acid ABC transporter, inner membrane protein |
|
amino acid ABC transporter, inner membrane protein |
| Sma0082 |
|
Gene: AZC_4407: amino acid ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
Gene: SMa0082: amino acid ABC transporter, substrate-binding protein |
|
amino acid ABC transporter, substrate-binding protein |
| Sma0083 |
|
Gene: AZC_4408: amino acid ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
|
|
Gene: SMa0083: amino acid ABC transporter, ATP-binding protein |
|
amino acid ABC transporter, ATP-binding protein |
| dgoK |
|
Gene: AZC_4409: 2-dehydro-3-deoxygalactonokinase (EC 2.7.1.58) |
|
|
|
|
|
|
|
|
|
|
|
|
|
2-dehydro-3-deoxygalactonokinase (EC 2.7.1.58) |
| dgoA |
|
Gene: AZC_4410: 2-dehydro-3-deoxyphosphogalactonate aldolase (EC 4.1.2.21) |
|
|
|
|
|
|
|
|
|
|
|
|
|
2-dehydro-3-deoxyphosphogalactonate aldolase (EC 4.1.2.21) |
| PF00389 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMa0085: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding |
|
D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding |
| RHE_PC00150 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMa0087: hypothetical protein |
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |