Profile of regulator KglR in Rhizobiales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | KglR - Rhizobiales |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Azorhizobium caulinodans ORS 571 | |||||
| AZC_4404 | kglR | -163 | 5.6 | GTTTTAGATCGGTCTAAAAA | |
| Sinorhizobium meliloti 1021 | |||||
| SMa0079 | Sma0079 | -77 | 5.9 | ATTTTAGATCGATCTAACTG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |