Regulon of KglR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMa0078
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	KglR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.9 Sequence: ATTTTAGATCGATCTAACTG Locus tag: SMa0079 Name: Sma0079 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: SMa0081 Name: Sma0081 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: SMa0082 Name: Sma0082 Funciton: amino acid ABC transporter, substrate-binding protein Locus tag: SMa0083 Name: Sma0083 Funciton: amino acid ABC transporter, ATP-binding protein Locus tag: SMa0085 Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding Locus tag: SMa0087 Name: null Funciton: hypothetical protein
	SMa0079	Sma0079	amino acid ABC transporter, inner membrane protein
	SMa0081	Sma0081	amino acid ABC transporter, inner membrane protein
	SMa0082	Sma0082	amino acid ABC transporter, substrate-binding protein
	SMa0083	Sma0083	amino acid ABC transporter, ATP-binding protein
	SMa0085	PF00389	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
	SMa0087		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD