Regulon of KglR in Azorhizobium caulinodans ORS 571

Properties
Regulator type:	Transcription factor
TF locus tag:	AZC_4404
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	KglR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 5.6 Sequence: GTTTTAGATCGGTCTAAAAA Locus tag: AZC_4404 Name: kglR Funciton: Transcriptional regulator, LacI family Locus tag: AZC_4405 Name: Sma0079 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: AZC_4406 Name: Sma0081 Funciton: amino acid ABC transporter, inner membrane protein Locus tag: AZC_4407 Name: Sma0082 Funciton: amino acid ABC transporter, substrate-binding protein Locus tag: AZC_4408 Name: Sma0083 Funciton: amino acid ABC transporter, ATP-binding protein Locus tag: AZC_4409 Name: dgoK Funciton: 2-dehydro-3-deoxygalactonokinase (EC 2.7.1.58) Locus tag: AZC_4410 Name: dgoA Funciton: 2-dehydro-3-deoxyphosphogalactonate aldolase (EC 4.1.2.21)
	AZC_4404	kglR	Transcriptional regulator, LacI family
	AZC_4405	Sma0079	amino acid ABC transporter, inner membrane protein
	AZC_4406	Sma0081	amino acid ABC transporter, inner membrane protein
	AZC_4407	Sma0082	amino acid ABC transporter, substrate-binding protein
	AZC_4408	Sma0083	amino acid ABC transporter, ATP-binding protein
	AZC_4409	dgoK	2-dehydro-3-deoxygalactonokinase (EC 2.7.1.58)
	AZC_4410	dgoA	2-dehydro-3-deoxyphosphogalactonate aldolase (EC 4.1.2.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD