Regulog SMb20014 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 5 | 1 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | 6 | 1 |
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | 6 | 1 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 6 | 1 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| SMc20018 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -73 score = 6.1672 sequence = ATATGAAACCGGTTACATTT Site: position = -51 score = 5.97693 sequence = CGATGTAAACGGTTTCATCG Gene: Atu4369: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -37 score = 6.0896 sequence = AATTGAAATCGATTTCATCG Gene: Meso_0266: Sugar ABC transporter, substrate-binding protein |
|
|
|
*
Rhizobium sp. NGR234 Site: position = -59 score = 6.0968 sequence = CATTGAAATCGATTACATTT Gene: NGR_b02560: Sugar ABC transporter, substrate-binding protein |
|
*
Sinorhizobium meliloti 1021 Site: position = -57 score = 5.96108 sequence = GATTGAAATCGATTACATTT Gene: SMb20018: Sugar ABC transporter, substrate-binding protein |
|
Sugar ABC transporter, substrate-binding protein |
| SMc20017 |
Gene: Atu4370: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
|
Gene: Meso_0265: Sugar ABC transporter, ATP-binding protein |
|
|
|
Gene: NGR_b02570: Sugar ABC transporter, ATP-binding protein |
|
Gene: SMb20017: Sugar ABC transporter, ATP-binding protein |
|
Sugar ABC transporter, ATP-binding protein |
| SMb20016 |
Gene: Atu4371: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
Gene: Meso_0264: Sugar ABC transporter, inner membrane protein |
|
|
|
Gene: NGR_b02580: Sugar ABC transporter, inner membrane protein |
|
Gene: SMb20016: Sugar ABC transporter, inner membrane protein |
|
Sugar ABC transporter, inner membrane protein |
| SMb20015 |
Gene: Atu4372: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
Gene: Meso_0263: Sugar ABC transporter, inner membrane protein |
|
|
|
Gene: NGR_b02590: Sugar ABC transporter, inner membrane protein |
|
Gene: SMb20015: Sugar ABC transporter, inner membrane protein |
|
Sugar ABC transporter, inner membrane protein |
| SMb20014 |
Gene: Atu4373: Transcriptional regulator, LacI family |
|
|
|
|
|
|
Gene: Meso_0262: Transcriptional regulator, LacI family |
|
|
|
Gene: NGR_b02600: Transcriptional regulator, LacI family |
|
Gene: SMb20014: Transcriptional regulator, LacI family |
|
Transcriptional regulator, LacI family |
| SMb0013 |
|
|
|
|
|
|
|
Gene: Meso_0261: Dehydrogenase, putative |
|
|
|
Gene: NGR_b02610: Dehydrogenase, putative |
|
Gene: SMb20013: Dehydrogenase, putative |
|
Dehydrogenase, putative |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |