Regulon of SMb20014 in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb20014
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20014 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6 Sequence: GATTGAAATCGATTACATTT Locus tag: SMb20018 Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: SMb20017 Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: SMb20016 Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMb20015 Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMb20014 Name: SMb20014 Funciton: Transcriptional regulator, LacI family Locus tag: SMb20013 Name: SMb0013 Funciton: Dehydrogenase, putative
	SMb20018	SMc20018	Sugar ABC transporter, substrate-binding protein
	SMb20017	SMc20017	Sugar ABC transporter, ATP-binding protein
	SMb20016	SMb20016	Sugar ABC transporter, inner membrane protein
	SMb20015	SMb20015	Sugar ABC transporter, inner membrane protein
	SMb20014	SMb20014	Transcriptional regulator, LacI family
	SMb20013	SMb0013	Dehydrogenase, putative

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD