Regulon of SMb20014 in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu4373
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20014 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6.2 Sequence: ATATGAAACCGGTTACATTT Position: -51 Score: 6 Sequence: CGATGTAAACGGTTTCATCG Locus tag: Atu4369 Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Atu4370 Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Atu4371 Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Atu4372 Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Atu4373 Name: SMb20014 Funciton: Transcriptional regulator, LacI family
	Atu4369	SMc20018	Sugar ABC transporter, substrate-binding protein
	Atu4370	SMc20017	Sugar ABC transporter, ATP-binding protein
	Atu4371	SMb20016	Sugar ABC transporter, inner membrane protein
	Atu4372	SMb20015	Sugar ABC transporter, inner membrane protein
	Atu4373	SMb20014	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD