Regulon of SMb20014 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b02600
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20014 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.1 Sequence: CATTGAAATCGATTACATTT Locus tag: NGR_b02560 Name: SMc20018 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: NGR_b02570 Name: SMc20017 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: NGR_b02580 Name: SMb20016 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: NGR_b02590 Name: SMb20015 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: NGR_b02600 Name: SMb20014 Funciton: Transcriptional regulator, LacI family Locus tag: NGR_b02610 Name: SMb0013 Funciton: Dehydrogenase, putative
	NGR_b02560	SMc20018	Sugar ABC transporter, substrate-binding protein
	NGR_b02570	SMc20017	Sugar ABC transporter, ATP-binding protein
	NGR_b02580	SMb20016	Sugar ABC transporter, inner membrane protein
	NGR_b02590	SMb20015	Sugar ABC transporter, inner membrane protein
	NGR_b02600	SMb20014	Transcriptional regulator, LacI family
	NGR_b02610	SMb0013	Dehydrogenase, putative

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD