Regulog Arth_2426 - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | ||
| Arthrobacter chlorophenolicus A6 | 5 | 2 |
| Arthrobacter sp. FB24 | 5 | 2 |
| Beutenbergia cavernae DSM 12333 | 3 | 1 |
| Brachybacterium faecium DSM 4810 | 3 | 1 |
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | 7 | 2 |
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| Arth_2426 |
Gene: AAur_3699: Sugar utilization transctriptional regulator, LacI family |
*
Arthrobacter chlorophenolicus A6 Site: position = -128 score = 6.24395 sequence = TTGGGAAAGCGCATTCCCAC Site: position = -79 score = 5.89967 sequence = GTTGGCAAGCGCTTTCCGGA Gene: Achl_2180: Sugar utilization transctriptional regulator, LacI family |
*
Arthrobacter sp. FB24 Site: position = -81 score = 5.74855 sequence = CATGGCAAGCGCTTTCCCGA Site: position = -129 score = 6.13504 sequence = CTGGGAAAGCGCATTCCCAC Gene: Arth_2426: Sugar utilization transctriptional regulator, LacI family |
Gene: Bcav_3360: Sugar utilization transctriptional regulator, LacI family |
Gene: Bfae_28980: Sugar utilization transctriptional regulator, LacI family |
|
|
*
Janibacter sp. HTCC2649 Site: position = -137 score = 5.39524 sequence = TGCGGAGAGCGCTTTCCGCT Gene: JNB_06194: Sugar utilization transctriptional regulator, LacI family |
|
|
|
|
|
|
Sugar utilization transctriptional regulator, LacI family |
| AAur_3697 |
Gene: AAur_3697: putative lipase/esterase |
Gene: Achl_2181: putative lipase/esterase |
Gene: Arth_2427: endo-1,4-beta-xylanase B |
|
|
|
|
|
|
|
|
|
|
|
putative lipase/esterase |
| CRON 2. | |||||||||||||||
| JNB_06199 |
|
|
|
|
|
|
|
*
Janibacter sp. HTCC2649 Site: position = -61 score = 5.39524 sequence = AGCGGAAAGCGCTCTCCGCA Gene: JNB_06199: Hydroxymethylpyrimidine ABC transporter, transmembrane component |
|
|
|
|
|
|
Hydroxymethylpyrimidine ABC transporter, transmembrane component |
| JNB_06204 |
|
|
|
|
|
|
|
Gene: JNB_06204: Hydroxymethylpyrimidine ABC transporter, substrate-binding component |
|
|
|
|
|
|
Hydroxymethylpyrimidine ABC transporter, substrate-binding component |
| JNB_06209 |
|
|
|
|
|
|
|
Gene: JNB_06209: Hydroxymethylpyrimidine ABC transporter, ATPase component |
|
|
|
|
|
|
Hydroxymethylpyrimidine ABC transporter, ATPase component |
| SCO2752 |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -110 score = 5.89967 sequence = TCCGGAAAGCGCTTGCCAAC Site: position = -61 score = 6.24395 sequence = GTGGGAATGCGCTTTCCCAA Gene: Achl_2179: Predicted glucose-fructose oxidoreductase |
*
Arthrobacter sp. FB24 Site: position = -55 score = 6.13504 sequence = GTGGGAATGCGCTTTCCCAG Site: position = -103 score = 5.74855 sequence = TCGGGAAAGCGCTTGCCATG Gene: Arth_2425: Predicted glucose-fructose oxidoreductase |
*
Beutenbergia cavernae DSM 12333 Site: position = -31 score = 5.84884 sequence = GCCGGAAAGCGCATTCCCTA Gene: Bcav_3365: Predicted glucose-fructose oxidoreductase |
*
Brachybacterium faecium DSM 4810 Site: position = -116 score = 5.50025 sequence = CTGGACAAGCGCTTGCCCGA Gene: Bfae_29090: Predicted glucose-fructose oxidoreductase |
|
|
Gene: JNB_06214: Predicted glucose-fructose oxidoreductase |
|
|
|
|
|
|
Predicted glucose-fructose oxidoreductase |
| SCO2751 |
Gene: AAur_3700: Conserved hypothetical protein, potentially related to sugar utilization |
Gene: Achl_2178: Conserved hypothetical protein, potentially related to sugar utilization |
Gene: Arth_2424: Conserved hypothetical protein, potentially related to sugar utilization |
Gene: Bcav_3366: Conserved hypothetical protein, potentially related to sugar utilization |
Gene: Bfae_29080: Conserved hypothetical protein, potentially related to sugar utilization |
|
|
Gene: JNB_06219: Conserved hypothetical protein, potentially related to sugar utilization |
|
|
|
|
|
|
Conserved hypothetical protein, potentially related to sugar utilization |
| SCO2750 |
Gene: AAur_3701: Predicted sugar phosphate isomerases/epimerase |
Gene: Achl_2177: Predicted sugar phosphate isomerases/epimerase |
Gene: Arth_2423: Predicted sugar phosphate isomerases/epimerase |
Gene: Bcav_3367: Predicted sugar phosphate isomerases/epimerase |
Gene: Bfae_29070: Predicted sugar phosphate isomerases/epimerase |
|
|
Gene: JNB_06224: Predicted sugar phosphate isomerases/epimerase |
|
|
|
|
|
|
Predicted sugar phosphate isomerases/epimerase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |