Regulon of Arth_2426 in Arthrobacter chlorophenolicus A6

Properties
Regulator type:	Transcription factor
TF locus tag:	Achl_2180
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Arth_2426 - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 6.2 Sequence: TTGGGAAAGCGCATTCCCAC Position: -79 Score: 5.9 Sequence: GTTGGCAAGCGCTTTCCGGA Locus tag: Achl_2180 Name: Arth_2426 Funciton: Sugar utilization transctriptional regulator, LacI family Locus tag: Achl_2181 Name: null Funciton: putative lipase/esterase
	Achl_2180	Arth_2426	Sugar utilization transctriptional regulator, LacI family
	Achl_2181		putative lipase/esterase
Position: -110 Score: 5.9 Sequence: TCCGGAAAGCGCTTGCCAAC Position: -61 Score: 6.2 Sequence: GTGGGAATGCGCTTTCCCAA Locus tag: Achl_2179 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: Achl_2178 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: Achl_2177 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
	Achl_2179	SCO2752	Predicted glucose-fructose oxidoreductase
	Achl_2178	SCO2751	Conserved hypothetical protein, potentially related to sugar utilization
	Achl_2177	SCO2750	Predicted sugar phosphate isomerases/epimerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD