Regulon of Arth_2426 in Beutenbergia cavernae DSM 12333

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcav_3360
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Arth_2426 - Micrococcineae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5.8 Sequence: GCCGGAAAGCGCATTCCCTA Locus tag: Bcav_3365 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: Bcav_3366 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: Bcav_3367 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
	Bcav_3365	SCO2752	Predicted glucose-fructose oxidoreductase
	Bcav_3366	SCO2751	Conserved hypothetical protein, potentially related to sugar utilization
	Bcav_3367	SCO2750	Predicted sugar phosphate isomerases/epimerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD