Regulon of Arth_2426 in Brachybacterium faecium DSM 4810

Properties
Regulator type:	Transcription factor
TF locus tag:	Bfae_28980
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Arth_2426 - Micrococcineae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 5.5 Sequence: CTGGACAAGCGCTTGCCCGA Locus tag: Bfae_29090 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: Bfae_29080 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: Bfae_29070 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
	Bfae_29090	SCO2752	Predicted glucose-fructose oxidoreductase
	Bfae_29080	SCO2751	Conserved hypothetical protein, potentially related to sugar utilization
	Bfae_29070	SCO2750	Predicted sugar phosphate isomerases/epimerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD